End Of Arm Tool Design

Please fill out the following fields: job name, sequence

One or more parameter you entered is not within range, guide RNA length should be between 4 and 50, homology arm length should be between 50 and 500, identity should be between 0 and 1 coverage should be between 0 to 1

PAM length should be between 3 and 10, and containing only letters "A", "T", "C", "G", "R", "Y", "S", "W", "K", "M", "B", "D", "H", "V", "N", no space(s).

To search guide RNA off-targets in your custom genome, please upload Fasta format genome sequence file, 200MB size limit. Please contact us if you wish to add a frequently used genome to our web-server

please paste your input sequence to search guide RNA in. Plain sequence or FASTA format.
plain sequence example:
ATGAGCGTAGCTGTGTGCATGTCAGTCGATGGGCATGCATGCATGCAT
Fasta formate example:
>Tc00.1047053503403.20-trans-sialidase
ATGCTCTCACGTGTTGATGCTGTCAAGGCACCCCGCACACACAACCGTCGCCGCGTGACCGGATCCAGCGGAAGGAGGAGGGAAGGAAGAGAGAGTGAGCCGCAGAGGCCCAACATGTCCCGGCATCACTTCTATTCTGCGGTGCTGCTCCTCCTCGTCGTGATGATGTGCCGCGGCAGTGGAGCTGCGCACGCTTTGGAGAGAAACTCAGGGGATTTGCAAATGCCGCAGGAGATCGCCATGTTTGTGCCGA
Note that sequence name will be truncated at space or special characters: ~!?@#$%^&*(){}[]"'/\,;:

A single gene example has been loaded, please keep T. cruzi genome selected to run the example

A multiple copy gene example has been loaded, this gene has >65 copies in the T. cruzi genome, please keep T. cruzi genome selected to run the example

Example 1 is a single locus gene that has 2 alleles in the T. cruzi CL strain genome
Example 2 is one member of the 65 member beta-galactofuranosyl-glycosyltransferase family. "On-target" guide RNA will be identified that target multiple gene family members. This analysis will also take significantly longer than single copy genes.

When determining gRNA on-targets, our program automatically compares the homology of each genomic hit to your gRNA-containing sequence. Sufficient homology would render a genomic hit to be an on-target. The homology arm length determines the length of the regions being compared. For example, homology arm length=50, 50bp upstream of gRNA and 50bp downstream of gRNA, plus gRNA (default 23bp), a total of 123bp will be used to determine homology

When determining guide RNA on-targets, our program automatically compares the homology of each genomic hit to your guide RNA-containing sequence. Sufficient homology would render a genomic hit to be an on-target. In such process, the identity parameter is the threshold for minimum alignment identity between genomic hits and guide RNA-containing sequence.

When determining guide RNA on-targets, our program automatically compares the homology of each genomic hit to your guide RNA-containing sequence. Sufficient homology would render a genomic hit to be an on-target. In such process, the coverage parameter is the threshold for minimum alignment coverage between genomic hits and guide RNA-containing sequence.

You selected a custom genome file to upload, but you didn't select the custom genome option, please select the "upload your custom genome" option under "custom genome" section and click "Get guide RNA" again.

You selected the option to upload a custom genome file, but you didn't select anyfile.

The gene sequence you entered is less than 100bp, EuPaGDT won't be able to accurately assess guide RNA on-targets in the genome .

When determining guide RNA off-targets, a genomic sequence will be considered potential off-target if the alignment of it with guide RNA has less than n mismatches. "n" is the "maximum number of mismatch" parameter value

RNA-guided nucleases such as Cas9 can cleave targets using alternative PAMs at lower efficiency.

For example SpCas9 can also use PAM "NAG", "NGA"(with lower efficiency compared to "NGG");
guide RNA "ATCGATCGATCGATCGATCG|NGG" could have the off-targets:
"ATCGATCGATCGATCGATCG|NAG",
"ATCGATCGATCGATCGATCG|NGA"
in undesired loci.

Please do not include special characters such as _!@#$%^&().,; in job names

Turning on this option will enable search for microhomology pairs bracketing each gRNA.
Microhomology pairs can, in some cases, mediate joining of double-stranded-breaks in the absence of a repair template.

Turning on this option will enable the evaulation of whether each gRNA hits a conserved region. Conserved regions are identified by tblastx (translated query vs translated database) input sequence against the following 13 genomes:
Mus Musculus,
S.cerevisiae S288c,
D. melanogaster r6.10,
N. crassa OR74A,
E. histolytica HM1IMSS-B,
C. parvum IowaII,
P. falciparum 3D7,
T. gondii ME49,
T. cruzi CLBrener,
L. donovani BPK282A1,
G. intestinalis AssemblageA,
E. cuniculi GBM1,
T. annulata Ankara.
A region of input sequence is marked as conserved region if tblastx-matches are found for at least 12 out of 13 genomes.

The following parameters will be automatically set if respective nuclease is chosen:

SpCas9: gRNA length 20; 3'PAM: NGG; off-target PAM: NAG, NGA

SaCas9: gRNA length 21; 3'PAM: NNGRRT; off-target PAM: NNGRRA,NNGRRG,NNGRRC

AsCpf1: gRNA length 20; 5'PAM: TTTN; off-target PAM: None

CjCas9: gRNA length 23; 3'PAM: NNNNACA; off-target PAM: NNNNACAC,NNNNRYAC

FnCas9: gRNA length 21; 3'PAM: NGG; off-target PAM: NGA,NAG,NAA

FnCpf1: gRNA length 23; 5'PAM: TTN,YG; off-target PAM: CTN

LbCpf1: gRNA length 20; 5'PAM: TTTN; off-target PAM: None

NmCas9: gRNA length 20; 3'PAM: NNNNGANN; off-target PAM: NNNNGTTN,NNNNGNNT,NNNNGTNN,NNNNGNTN

St1Cas9: gRNA length 20; 3'PAM: NNAGAA,NNGGAA; off-target PAM: NNAGGA,NNANAA,NNGGGA

TdCas9: gRNA length 20; 3'PAM: NAAAAC; off-target PAM: None

CasPhi-1: gRNA length 20; 5'PAM: VTTR; off-target PAM: None

CasPhi-2: gRNA length 20; 5'PAM: TBN; off-target PAM: None

CasPhi-3: gRNA length 20; 5'PAM: VTTN; off-target PAM: None

Batch design gRNA and corresponding HDR templates to insert tags before start codons and after stop codons.

Please use IUPAC code for degenerative base(s) in PAM motif

IUPAC nucleotide code	Base
A	Adenine
C	Cytosine
G	Guanine
T	Thymine
R	A or G
Y	C or T
S	G or C
W	A or T
K	G or T
M	A or C
B	C or G or T
D	A or G or T
H	A or C or T
V	A or C or G
N	any base

Reference: IUPAC-IUB SYMBOLS FOR NUCLEOTIDE NOMENCLATURE: Cornish-Bowden (1985) Nucl. Acids Res. 13: 3021-3030.

Turning on the chimeric gRNA option will output the gRNA in DNA/RNA hybrid form.

The first ten bases will be DNA, and the rest will be RNA.

For SaCas9 and CjCas9 jobs, the following scaffolds will be appended to create crRNA. [link to the crRNA reference]
SaCas9: 5'-GUUUUAGUACUCUGG-3'
CjCas9: 5'-GUUUUAGUCCCUG-3'

Eukaryotic Pathogen CRISPR guide RNA/DNA Design Tool

with (1) custom genome upload, (2) off-target analysis, (3) on-targets searching (for targeting gene families), (4) efficiency/activity prediction, (5) assisted oligo repair template design , (6) guide RNA transcription problem identification, (7) flanking microhomology searching (for predicting deletions)

batch mode available here

Gene tagging batch mode available here (?)

Our CRISPR/Cas gRNA design tool has a new look!!

Job Name:

RNA guided nuclease selection: (?)

optional search:

Microhomology search: (?) on off
Conserved region search: (?) on off

Additional option settings: (click to expand a category)

guide RNA search parameters

guide RNA length:

PAM motif(s):
(use comma to separate multiple PAM motifs
use IUPAC code for degenerate base)

PAM position: 3' end 5' end

Chimeric gRNA (?)
(change first 8-10bp into DNA): on off

Optional:
append the following sequence
to the gRNA to form a crRNA

Please note that, if the Chimeric option is "on":
5'-GUUUUAGUACUCUGG-3' will be appended to SaCas9 gRNAs
5'-GUUUUAGUCCCUG-3' will be appended to CjCas9 gRNAs

on-target search parameters

(Default settings
recommended for most users)

homology arm length: (?)
identity: (?)
coverage: (?)

off-target search parameters

(Default settings
recommended for most users)

seed sequence length (including PAM):

maximum number
of mismatches: (?)

off-target PAM motif(s)(?):
(comma separated if more than one,
use IUPAC code for degenerate base)

HDR repair template parameters

(Default settings
recommended for most users)

homology arm length:(?)

Genome (expand a category and choose one):

(?)	(?)

(please use Chrome browser or enable Javascript in your browser for optimal results)